| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.064870 |
| Chromosome: | chromosome 12 |
| Location: | 4750731 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g523950 | (1 of 1) PTHR21229//PTHR21229:SF2 - LUNG SEVEN TRANSMEMBRANE RECEPTOR // PROTEIN C15H9.5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGTCGCCACAAGACTCCGCGGTCGCACC |
| Internal bar code: | TGGCCTCAAGGTACATCCATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 797 |
| LEAP-Seq percent confirming: | 99.2613 |
| LEAP-Seq n confirming: | 3225 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCAGTCTCCCCGTTTTT |
| Suggested primer 2: | TTCCTATCACCAGTGGAGGC |