Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.064927 |
Chromosome: | chromosome 15 |
Location: | 1696487 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g644051 | (1 of 7) PF12680 - SnoaL-like domain (SnoaL_2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGTATCTACAACCCCCACGGTCCGCTTA |
Internal bar code: | GCCACGCGTAAGTAATCACGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 857 |
LEAP-Seq percent confirming: | 99.5257 |
LEAP-Seq n confirming: | 36718 |
LEAP-Seq n nonconfirming: | 175 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGAAGTAGCGATTTTCCGC |
Suggested primer 2: | GAACACCGGTAAAGCGGTTA |