Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.065027 |
Chromosome: | chromosome 6 |
Location: | 3681405 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g278139 | RAB18B | Small Rab-related GTPase; (1 of 3) K07910 - Ras-related protein Rab-18 (RAB18) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCGCAGGCTGGCCTGAGCCCAGGACGC |
Internal bar code: | TTTTTCGAAGCAATGAAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 95.4545 |
LEAP-Seq n confirming: | 21 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTGTCCTCTCATGCTCCA |
Suggested primer 2: | CCCTTGGAAACTTGCATTGT |