Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.065136 |
Chromosome: | chromosome 16 |
Location: | 3862921 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g689950 | (1 of 1) PF00168//PF08372 - C2 domain (C2) // Plant phosphoribosyltransferase C-terminal (PRT_C) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCCCACCAAATGCGCCATCCGGTCACA |
Internal bar code: | CGGATTAGCCCTTGGCCACGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 714 |
LEAP-Seq percent confirming: | 99.3151 |
LEAP-Seq n confirming: | 145 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCCAAGCCTTGCAGTTAG |
Suggested primer 2: | CACCAGCTGCTCGTAATTCA |