| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.065137 |
| Chromosome: | chromosome 12 |
| Location: | 3258812 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498350 | RBM25,SRE1,SRS7 | Pre-mRNA splicing factor, SR-related; (1 of 1) K13168 - splicing factor, arginine/serine-rich 16 (SFRS16) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGCAGGACGAGGGAGCCATCCTGGACG |
| Internal bar code: | TGTCTCCGGGGGCCTTCTATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 646 |
| LEAP-Seq percent confirming: | 97.1393 |
| LEAP-Seq n confirming: | 781 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATTATGCGGTCACGTGTT |
| Suggested primer 2: | CGTCCCCTCTTGAGCTACTG |