| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.065145 |
| Chromosome: | chromosome 10 |
| Location: | 1688947 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430150 | REP27,LPA1 | (1 of 1) PF11998//PF13414 - Protein of unknown function (DUF3493) (DUF3493) // TPR repeat (TPR_11); Low Photosystem II Accumulation 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCCACCCGCTGGACTCCCACTCTGGAC |
| Internal bar code: | TCTGGGATACGATGTATGTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 841 |
| LEAP-Seq percent confirming: | 99.696 |
| LEAP-Seq n confirming: | 3280 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAACTGCTACATCCAGGT |
| Suggested primer 2: | GTTTCGAATGTGGCAATGTG |