Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.065169 |
Chromosome: | chromosome 8 |
Location: | 842235 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g361000 | (1 of 1) PTHR31187//PTHR31187:SF0 - FAMILY NOT NAMED // TLC ATP/ADP TRANSPORTER | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATGAACGGCTACCCCCCCTCCCCCCAT |
Internal bar code: | CGTGTCCGTACACGCGTCAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 761 |
LEAP-Seq percent confirming: | 99.5626 |
LEAP-Seq n confirming: | 3187 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATGGGATGGTGTGTATCA |
Suggested primer 2: | AACCAATGTCAAGTAGGCCG |