| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.065175 |
| Chromosome: | chromosome 1 |
| Location: | 6461379 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g045903 | DGAT1 | (1 of 1) K11155 - diacylglycerol O-acyltransferase 1 (DGAT1); Diacylglycerol O-acyltransferase, Type 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCATCAAGGTGTGCCACCCCCTCCCCT |
| Internal bar code: | TGTCAAATATCCTCTCATCTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 207 |
| LEAP-Seq percent confirming: | 98.4177 |
| LEAP-Seq n confirming: | 311 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTAGTTTGGGCCGGTATT |
| Suggested primer 2: | CAAGGCGAGTAGGTCTGGAG |