| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.065231 |
| Chromosome: | chromosome 9 |
| Location: | 6618904 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408550 | SAE1 | (1 of 1) K10684 - ubiquitin-like 1-activating enzyme E1 A (UBLE1A, SAE1); SUMO activating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGGCAGCCCAGGTGACAGCCCAGCACA |
| Internal bar code: | GTAGGTCGGCGGACGTGGACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1153 |
| LEAP-Seq percent confirming: | 99.7303 |
| LEAP-Seq n confirming: | 9616 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCCCGCAACATCTAATCT |
| Suggested primer 2: | TCCACTGCTACAGCCATCAG |