| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.065234 |
| Chromosome: | chromosome 8 |
| Location: | 4124575 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g379800 | (1 of 1) PF00207//PF07974 - Alpha-2-macroglobulin family (A2M) // EGF-like domain (EGF_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACGAATCCGGCCCCAGAGCTGGTCGA |
| Internal bar code: | CTGCGCAGTGTCCGCTATGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 99.8426 |
| LEAP-Seq n confirming: | 6342 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTGACGACCATACATGC |
| Suggested primer 2: | CGTCATTTTGCACAACATCC |