| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.065274 |
| Chromosome: | chromosome 1 |
| Location: | 1380008 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g006900 | (1 of 6) PTHR22870//PTHR22870:SF201 - REGULATOR OF CHROMOSOME CONDENSATION // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGTACCAGCCAGCTGCAGGCAGGAATGT |
| Internal bar code: | GTACATCGACGCCGCAATGCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 621 |
| LEAP-Seq percent confirming: | 99.6726 |
| LEAP-Seq n confirming: | 2131 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGGTCGAAATATTGGAA |
| Suggested primer 2: | GGATGTTTGGAAAAGCGGTA |