| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.065310 |
| Chromosome: | chromosome 16 |
| Location: | 6063198 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676200 | (1 of 3) PTHR10751:SF2 - GUANYLATE-BINDING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGTGCGGGTAGGGGAGGGTCCGGGTG |
| Internal bar code: | GTATTCCGGAGGTTTGTGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 315 |
| LEAP-Seq percent confirming: | 89.313 |
| LEAP-Seq n confirming: | 468 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTTTCTTCAAAGACGCAC |
| Suggested primer 2: | TCACCCCGCTTTATCTCTTG |