Insertion junction: LMJ.RY0402.065355_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.065355
Chromosome:chromosome_6
Location:1731526
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCCCCTAACCCCCAAACCCTTAAACCCTA
Internal bar code:CGGACAATTGGGTCTGGGGCCG

Confirmation - LEAP-Seq

LEAP-Seq distance:901
LEAP-Seq percent confirming:99.6727
LEAP-Seq n confirming:9439
LEAP-Seq n nonconfirming:31
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:GTATGAAGGTCACCGCCTGT
Suggested primer 2:TTGTTTATGACTTCGCGCTG