| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.065571 |
| Chromosome: | chromosome 10 |
| Location: | 5763544 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g461150 | serine/threonine protein kinase; (1 of 38) IPR000719//IPR002290//IPR011009 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGGATAAGCTGATCAGCCAGGAATTCT |
| Internal bar code: | AATCCCATGATAGTCGGGCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 682 |
| LEAP-Seq percent confirming: | 99.3861 |
| LEAP-Seq n confirming: | 3076 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCACCCTCAACCTTTGAC |
| Suggested primer 2: | GACACCTTCGAGGAGAGTGC |