Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.065632 |
Chromosome: | chromosome 3 |
Location: | 8134495 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g200750 | DMC1 | Putative DNA methylase; (1 of 1) IPR027417//IPR029063 - P-loop containing nucleoside triphosphate hydrolase // S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAACCGAGTGTGGCGTTGCGGTGTGTCT |
Internal bar code: | GTAGAAATGAAATCTCGGCACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 646 |
LEAP-Seq percent confirming: | 99.1203 |
LEAP-Seq n confirming: | 2817 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTCGGACGAGTGTACATA |
Suggested primer 2: | GAACACAGCTCGAACAACGA |