Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.065677 |
Chromosome: | chromosome 12 |
Location: | 4411856 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g520950 | BOP5,IDA-IC138,IC138,DIC4 | Axonemal inner dynein arm I1 intermediate chain; (1 of 1) PTHR12442:SF12 - WD REPEAT-CONTAINING PROTEIN 78 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCTGTTGCTCAGCTGAGCAGAACCAGC |
Internal bar code: | CATGCCGGTTCTCTAACGGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 563 |
LEAP-Seq percent confirming: | 99.7279 |
LEAP-Seq n confirming: | 5865 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTACTCCAAGCACCAAC |
Suggested primer 2: | GGATGAAAGCGATGTGAGGT |