Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.065726 |
Chromosome: | chromosome 1 |
Location: | 5100152 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g035450 | (1 of 1) PTHR23291:SF36 - PROTEIN XBX-6, ISOFORM B | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGATTACGCACTTGGTTGCGCGGAGCT |
Internal bar code: | GGGGGATGCTGGAGCGTTGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 747 |
LEAP-Seq percent confirming: | 99.5507 |
LEAP-Seq n confirming: | 1551 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGAATGAGAACTGGCCGCT |
Suggested primer 2: | TTCCCTCTCACCTGATGGAC |