Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.065759 |
Chromosome: | chromosome 9 |
Location: | 4756463 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g397216 | (1 of 3) K01832 - thromboxane-A synthase (TBXAS1, CYP5A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTGTGTGTTGATGAAACAACAGAAGC |
Internal bar code: | GTGCGGTACGCACAGGCCCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 99 |
LEAP-Seq percent confirming: | 38.855 |
LEAP-Seq n confirming: | 1337 |
LEAP-Seq n nonconfirming: | 2104 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCCTCACAACCCGTCTAT |
Suggested primer 2: | ACACTCGCACACTTGCTCAC |