Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.065798 |
Chromosome: | chromosome 10 |
Location: | 1811424 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g431050 | SRR13 | (1 of 1) PTHR19331//PTHR19331:SF253 - LYSYL OXIDASE-RELATED // SUBFAMILY NOT NAMED; Speract/scavenger receptor, transmembrane glycoprotein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTACGAGAACAGCCAGTCCAAGCTGCTG |
Internal bar code: | TGTGATAGAATCTTGATACTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1240 |
LEAP-Seq percent confirming: | 99.6467 |
LEAP-Seq n confirming: | 7898 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTGCGGCGTCTTAATCTC |
Suggested primer 2: | TAGACGGTCGGAAGCTCTGT |