Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.065907 |
Chromosome: | chromosome 3 |
Location: | 2391563 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g158900 | RBP63,DLA2 | Dihydrolipoamide acetyltransferase; (1 of 1) PTHR23151//PTHR23151:SF61 - DIHYDROLIPOAMIDE ACETYL/SUCCINYL-TRANSFERASE-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGACTGGCATATTCAGTGCAGACGCGC |
Internal bar code: | GCGTGGCGATCATGGGGAGATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 970 |
LEAP-Seq percent confirming: | 99.4472 |
LEAP-Seq n confirming: | 1619 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAGCCCACCTAGTAGCTT |
Suggested primer 2: | CATCACCTACAGCAGCCAGA |