Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.066106 |
Chromosome: | chromosome 8 |
Location: | 4399118 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g381950 | YAK1,TAR1 | (1 of 1) K18670 - dual specificity protein kinase YAK1 [EC:2.7.12.1] (YAK1); DYRK-type protein kinase/Yet-another-kinase 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAGGTGGTACACCCGATTCCCATTGTCA |
Internal bar code: | ACGCAGTAGCACTGTGGTCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 268 |
LEAP-Seq percent confirming: | 29.7634 |
LEAP-Seq n confirming: | 1220 |
LEAP-Seq n nonconfirming: | 2879 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTGGTGCTGGTGTATGT |
Suggested primer 2: | AGAGTCGTCCCTGCTACTGC |