| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.066374 |
| Chromosome: | chromosome 16 |
| Location: | 3647307 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g688450 | CFAP298,DAB2,C21ORF59,FBB18 | (1 of 1) PF11069 - Protein of unknown function (DUF2870) (DUF2870); Flagellar basal body proteome 18 / Dynein assembly factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATAGACTCCCGAGCGGGAACGACAACTA |
| Internal bar code: | GGGTCAGGAGGTAGGCGACAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 76.8382 |
| LEAP-Seq n confirming: | 2090 |
| LEAP-Seq n nonconfirming: | 630 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTAGTAATTCCGCAAGGA |
| Suggested primer 2: | GGCAATGATGGCGTTCTACT |