| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.066385 |
| Chromosome: | chromosome 10 |
| Location: | 1454601 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428650 | CDPKK1,CDPKKK1 | (1 of 3) K07359 - calcium/calmodulin-dependent protein kinase kinase (CAMKK); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCTCTGATAAGGCCGCGGCATCTGTGTT |
| Internal bar code: | TCGCTTCGCACTTGGGGGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 188 |
| LEAP-Seq percent confirming: | 74.3546 |
| LEAP-Seq n confirming: | 2160 |
| LEAP-Seq n nonconfirming: | 745 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAAGAGAACAGGGCAAAG |
| Suggested primer 2: | CTGCTGCTGGTGATGGAGTA |