| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066398 |
| Chromosome: | chromosome 4 |
| Location: | 2904499 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224550 | GT90F37,GT90-37 | (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90); GT90 family protein 37 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCAGGGAGTTGGAGGGGAAGTGGCTAG |
| Internal bar code: | ACGCAAGGGGGAGGGCGGGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 267 |
| LEAP-Seq percent confirming: | 99.6633 |
| LEAP-Seq n confirming: | 296 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATGTGCCAGGTTGTTAT |
| Suggested primer 2: | GGGCGGATCTTTGATACTGA |