| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066422 |
| Chromosome: | chromosome 7 |
| Location: | 2636557 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330400 | KCN1 | (1 of 1) K04886 - potassium voltage-gated channel Shab-related subfamily B member 2 (KCNB2); Six-transmembrane domain potassium channel alpha subunit | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCACTGCATTGTCACTGCTGTCCAGGGC |
| Internal bar code: | AGTCAGGGGCGCGATCCTTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 885 |
| LEAP-Seq percent confirming: | 99.6706 |
| LEAP-Seq n confirming: | 7262 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTACGGTCTTCCGACTT |
| Suggested primer 2: | CTGTTAGCGCAAAAACGTCA |