Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.066468 |
Chromosome: | chromosome 14 |
Location: | 2514797 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625300 | CAX3 | (1 of 1) PTHR12266//PTHR12266:SF9 - NA+/CA2+ K+ INDEPENDENT EXCHANGER // CATION/CALCIUM EXCHANGER 3-RELATED; CAX family cation antiporter, membrane protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACCCCAGTGTGCAATCCAATACGTCCAC |
Internal bar code: | CACGAGTCGTTGGATGATGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 593 |
LEAP-Seq percent confirming: | 98.8967 |
LEAP-Seq n confirming: | 2241 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCATACACGCTCTCTCACA |
Suggested primer 2: | TACGCCAACCAGTCCCTTAC |