| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.066471 |
| Chromosome: | chromosome 3 |
| Location: | 2690692 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g161250 | CYP748A1,CYP14 | (1 of 2) PTHR24305:SF65 - CYTOCHROME P450 12A4, MITOCHONDRIAL-RELATED; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACGCAGGCACGCCGCCGCAACCCCCAG |
| Internal bar code: | AAGTGGAACGGGGGCTGATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 331 |
| LEAP-Seq percent confirming: | 52.9412 |
| LEAP-Seq n confirming: | 414 |
| LEAP-Seq n nonconfirming: | 368 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGACATCCAGGAACACT |
| Suggested primer 2: | TTGGTGGCTGGATAAGGAAG |