| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066491 |
| Chromosome: | chromosome 17 |
| Location: | 1140971 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g704300 | FAP47 | Flagellar Associated Protein 47; (1 of 1) PTHR23053//PTHR23053:SF2 - DLEC1 DELETED IN LUNG AND ESOPHAGEAL CANCER 1 // PRIMARY CILIARY DYSKINESIA PROTEIN 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTTCCCAGTCTCCACCGCGCCCTGCTC |
| Internal bar code: | GTGTTGCCCATCGCCTAGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 55 |
| LEAP-Seq percent confirming: | 99.1429 |
| LEAP-Seq n confirming: | 347 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACACGCAACCAAAACAC |
| Suggested primer 2: | CGGTATGTCACAACTGTCGG |