| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066542 |
| Chromosome: | chromosome 16 |
| Location: | 5723609 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678900 | HIK,HKR6,HIK6 | (1 of 3) IPR001789//IPR011006 - Signal transduction response regulator, receiver domain // CheY-like superfamily; Response regulator of two-component system | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCTCCCCGGCGCCCCCGGCCTGCGCAG |
| Internal bar code: | GCTAGCTTAGACGTTGTTGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 810 |
| LEAP-Seq percent confirming: | 99.4008 |
| LEAP-Seq n confirming: | 20405 |
| LEAP-Seq n nonconfirming: | 123 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACATGCTTAATGGGGCACA |
| Suggested primer 2: | GAAACCAAGCTGCAGTGACA |