Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.066609 |
Chromosome: | chromosome 2 |
Location: | 1562821 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g084800 | SPO11A | (1 of 1) K10878 - meiotic recombination protein SPO11 (SPO11); meoisis-related DNA topoisomerase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCAGTCGCAGTCGGACGCCATTTTGGA |
Internal bar code: | ATCCGTTGCCGAGGTGTGGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 293 |
LEAP-Seq percent confirming: | 60.8079 |
LEAP-Seq n confirming: | 1114 |
LEAP-Seq n nonconfirming: | 718 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACTGGACCTTCCCTACCA |
Suggested primer 2: | GAGTGGCTCATCTCCTCCTG |