| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.066625 |
| Chromosome: | chromosome 6 |
| Location: | 2898377 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g272300 | CPLD57 | (1 of 1) PTHR23029:SF45 - PHOSPHOGLYCERATE MUTASE FAMILY PROTEIN; Phosphoglycerate mutase family protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTAGGCCACCACCTGCCAACACCGGG |
| Internal bar code: | GGAGCCATATACTTTCGGATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 817 |
| LEAP-Seq percent confirming: | 95.6153 |
| LEAP-Seq n confirming: | 2595 |
| LEAP-Seq n nonconfirming: | 119 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACAGAACGCCTACCAGA |
| Suggested primer 2: | CAAGATGCAGCTGAAACCAA |