| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.066648 |
| Chromosome: | chromosome 2 |
| Location: | 6348998 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115300 | AOT6 | Amino acid transporter; (1 of 1) PTHR22950:SF72 - SODIUM-COUPLED NEUTRAL AMINO ACID TRANSPORTER 6-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGGCCATTACCCAAGCCCCACCAAGGG |
| Internal bar code: | CTCTGGAGTCAGCGCTTCTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 388 |
| LEAP-Seq percent confirming: | 99.9104 |
| LEAP-Seq n confirming: | 2231 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGCGTCCTTTAACCAAC |
| Suggested primer 2: | CGGCAATCTTGGTATTGAGG |