| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.066713 |
| Chromosome: | chromosome 13 |
| Location: | 4533069 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g602700 | SPA1 | Part of COP1/SPA complex E3 ubiquitin ligase complex; (1 of 1) K16240 - protein suppressor of PHYA-105 1 (SPA1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCCGCGTGGTCACCAACAACGCTCAGC |
| Internal bar code: | GGACTAAGAGCAAGATAGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 92 |
| LEAP-Seq percent confirming: | 99.8155 |
| LEAP-Seq n confirming: | 1082 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGGCTAGCTACGACTTC |
| Suggested primer 2: | ATAAGTGTGTGTCCGAGCCC |