Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.066781 |
Chromosome: | chromosome 13 |
Location: | 1318900 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g571251 | (1 of 8) IPR001163//IPR010920 - LSM domain, eukaryotic/archaea-type // LSM domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACCCGCTGAGGGCGCTCCACACGCCGGG |
Internal bar code: | GGCTCGGGACGCACGGTGATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 470 |
LEAP-Seq percent confirming: | 99.65 |
LEAP-Seq n confirming: | 1993 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCACACAAGGGTTTGCTT |
Suggested primer 2: | AAAGGGCAACTGCACCATAC |