| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066786 |
| Chromosome: | chromosome 13 |
| Location: | 3242525 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g585800 | SUB2 | Secreted serine protease, subtilase-type; (1 of 2) 3.4.21.111 - Aqualysin 1 / Caldolysin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCCCGCGGCACGGGGTTGGGGTTGGGC |
| Internal bar code: | TCCGCTCGATTGGGGGGTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 231 |
| LEAP-Seq percent confirming: | 50.3909 |
| LEAP-Seq n confirming: | 2643 |
| LEAP-Seq n nonconfirming: | 2602 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCAGTAGTGGACACACCC |
| Suggested primer 2: | GTTTACCACATACGGGGACG |