| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.066824 |
| Chromosome: | chromosome 9 |
| Location: | 7701059 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g415650 | FAP351 | Flagellar Associated Protein 351; (1 of 7) PF07004 - Sperm-tail PG-rich repeat (SHIPPO-rpt) | 5'UTR_intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCATAGTGCCGATGAAGAAACAGTCAACT |
| Internal bar code: | CTGTGGGCTTTCTATCAAAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 650 |
| LEAP-Seq percent confirming: | 99.8542 |
| LEAP-Seq n confirming: | 1370 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTGGTTGACGGCAAAAAT |
| Suggested primer 2: | CTCAAAAGGCAGAGGGACTG |