| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.066856 |
| Chromosome: | chromosome 13 |
| Location: | 3413702 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g587200 | PIGW1,PIGW | Inositol acyltransferase, PIG-W; (1 of 1) K05283 - phosphatidylinositol glycan, class W (PIGW) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCTGCTCTTGCTCTGCCTGGCTTAAAC |
| Internal bar code: | GATAGGCTCTCCCTGGCCGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 764 |
| LEAP-Seq percent confirming: | 99.5981 |
| LEAP-Seq n confirming: | 3965 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACGTTAGCGCTGTGGTA |
| Suggested primer 2: | GATTCGTGCCAGATGGTTTT |