| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.066951 |
| Chromosome: | chromosome 7 |
| Location: | 5846428 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g353555 | (1 of 3) IPR002912//IPR011598 - ACT domain // Myc-type, basic helix-loop-helix (bHLH) domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTATGCCGGACTTCGTGCATTGTGTATA |
| Internal bar code: | CAGTTCACGATGGCGGAAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 318 |
| LEAP-Seq percent confirming: | 99.2092 |
| LEAP-Seq n confirming: | 2760 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGCTTGCTTGCATACAG |
| Suggested primer 2: | GAAGTCGTACAGGCTGGCTC |