| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.067014 |
| Chromosome: | chromosome 16 |
| Location: | 4682128 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687301 | SRH26 | (1 of 1) K15192 - TATA-binding protein-associated factor [EC:3.6.4.-] (BTAF1, MOT1); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGGGAGCCGCCTCCCCGCAAGACTTGC |
| Internal bar code: | CAGCCGGGGGTAATCAGTGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 157 |
| LEAP-Seq percent confirming: | 47.8689 |
| LEAP-Seq n confirming: | 438 |
| LEAP-Seq n nonconfirming: | 477 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTGTGTTGTGTAGCGGC |
| Suggested primer 2: | TACGCGGAAGTGTAATGCAG |