Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.067181 |
Chromosome: | chromosome 10 |
Location: | 1500022 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g428750 | (1 of 1) K14792 - rRNA biogenesis protein RRP5 (RRP5, PDCD11) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGCGGAGGCGCGATTGCGGGCGCTGCG |
Internal bar code: | GATCTCGTTCACGGGCTTAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 162 |
LEAP-Seq percent confirming: | 43.5536 |
LEAP-Seq n confirming: | 679 |
LEAP-Seq n nonconfirming: | 880 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGTGACCCCCTTCCGTTT |
Suggested primer 2: | ATGTTGTGACCAGTCCGTGA |