| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.067334 |
| Chromosome: | chromosome 9 |
| Location: | 7500077 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g413950 | EFH6 | EF-hand Calcium binding protein; (1 of 5) PTHR23050:SF90 - CENTRIN-3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGATCCCGGGCCACGCCCCGCAGATTT |
| Internal bar code: | CGCTGGTGGATATGATCAGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 42 |
| LEAP-Seq percent confirming: | 94.5546 |
| LEAP-Seq n confirming: | 6199 |
| LEAP-Seq n nonconfirming: | 357 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGTGCGTGTTGTATGACC |
| Suggested primer 2: | GAACAGCCATAGGTGGTGCT |