Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.067378 |
Chromosome: | chromosome 16 |
Location: | 4971289 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g685250 | SUB11 | (1 of 5) PTHR10795//PTHR10795:SF157 - PROPROTEIN CONVERTASE SUBTILISIN/KEXIN // MEMBRANE-BOUND TRANSCRIPTION FACTOR PEPTIDASE, SITE 1; Subtilisin-like protease | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGTAATTGTGGCAAACCACACCAGCGGC |
Internal bar code: | GGGATGACTGCCACAAGTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 527 |
LEAP-Seq percent confirming: | 99.0 |
LEAP-Seq n confirming: | 693 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTGCGAAAATGACTACCC |
Suggested primer 2: | ACAATGATCTTCCGTGCCTC |