| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.067395 |
| Chromosome: | chromosome 6 |
| Location: | 2969824 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273250 | GPA2,GPAT2 | Glycerol-3-phosphate acyltransferase; (1 of 1) K13506 - glycerol-3-phosphate O-acyltransferase 3/4 (GPAT3_4, AGPAT9, AGPAT6) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCATGAGCAGTGTTAGCCGCACCGGGAA |
| Internal bar code: | GAGTCGTGCCCGCGGCACCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 302 |
| LEAP-Seq percent confirming: | 77.9319 |
| LEAP-Seq n confirming: | 3708 |
| LEAP-Seq n nonconfirming: | 1050 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTTCATCGACCCTTGCTC |
| Suggested primer 2: | AGAGCACAGGCGAAAACCTA |