| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.067397 |
| Chromosome: | chromosome 3 |
| Location: | 4538990 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176651 | MYSM1 | (1 of 1) PF00249//PF01398 - Myb-like DNA-binding domain (Myb_DNA-binding) // JAB1/Mov34/MPN/PAD-1 ubiquitin protease (JAB); Histone H2A deubiquitinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGAGTCGCTGCTGGGGCTGCTGTTCGGG |
| Internal bar code: | TGACGTGCACGCCAAGTCTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 75 |
| LEAP-Seq percent confirming: | 99.7636 |
| LEAP-Seq n confirming: | 422 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTTCGAAGCAAACTACC |
| Suggested primer 2: | TGTGGCGCAACTACAGCTAC |