| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.067431 |
| Chromosome: | chromosome 8 |
| Location: | 1682971 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g365750 | (1 of 6) IPR006502//IPR011333 - Protein of unknown function PDDEXK-like // POZ domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTAGGTGGATGGAAGCCGCCGACAACT |
| Internal bar code: | GGGGTGTGAAAACGTGAAGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1005 |
| LEAP-Seq percent confirming: | 56.8286 |
| LEAP-Seq n confirming: | 1111 |
| LEAP-Seq n nonconfirming: | 844 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCTCCAGTTCGCCTACAC |
| Suggested primer 2: | ATACCGTACATCCGCCACAT |