| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.067492 |
| Chromosome: | chromosome 13 |
| Location: | 3673338 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588900 | WEX,EXN15 | (1 of 7) IPR002562//IPR012337 - 3'-5' exonuclease domain // Ribonuclease H-like domain; putative Werner syndrome-like exonuclease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCTGCGGCGGCGGCTGCCCACTCACCGC |
| Internal bar code: | TCGTCCGTCCGTTCAGAAAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 122 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTGGAGATGGTTTGAGGC |
| Suggested primer 2: | GAGAGTGGCATGGGAGAGTC |