| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.067529 |
| Chromosome: | chromosome 9 |
| Location: | 4982644 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397993 | FAP201 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype; Leucine Rich Repeat Flagellar Associated Protein 201 | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAACAGAACTAAGCGAAGATTAGCATGGC |
| Internal bar code: | GTGGCAGTGCTTCCGGCCTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 380 |
| LEAP-Seq percent confirming: | 97.931 |
| LEAP-Seq n confirming: | 142 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTGAGAGCTAGGAGGCA |
| Suggested primer 2: | GACTAGGCAGAAGCACCAGG |