Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.067549 |
Chromosome: | chromosome 15 |
Location: | 320082 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g635750 | (1 of 1) IPR003613//IPR016024 - U box domain // Armadillo-type fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGACATGTGGACAGGTGGGGTGGGCTGT |
Internal bar code: | TTCGGTTTGGCGTGTTGTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 175 |
LEAP-Seq percent confirming: | 78.7447 |
LEAP-Seq n confirming: | 3927 |
LEAP-Seq n nonconfirming: | 1060 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCGCTTTTCCAAACAACC |
Suggested primer 2: | GCGTGTTTATGATGTGGACG |