Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.067571 |
Chromosome: | chromosome 10 |
Location: | 3857962 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g447550 | (1 of 2) PF03200 - Glycosyl hydrolase family 63 C-terminal domain (Glyco_hydro_63) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTATCTCCACCGGCAGTGGCATTTCCA |
Internal bar code: | GTATCATGGCACAGGACGGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 227 |
LEAP-Seq percent confirming: | 81.6337 |
LEAP-Seq n confirming: | 1649 |
LEAP-Seq n nonconfirming: | 371 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATAACGACACAGGGGCACA |
Suggested primer 2: | ACCATTCCCATAAAGAGGGG |