Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.067616 |
Chromosome: | chromosome 9 |
Location: | 1955198 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g394900 | CYA10 | (1 of 1) IPR000209//IPR001054//IPR029787 - Peptidase S8/S53 domain // Adenylyl cyclase class-3/4/guanylyl cyclase // Nucleotide cyclase; Solute-binding protein-like adenylate cyclase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCGCAAAGCTAGGGCTGAAAGCGCCAT |
Internal bar code: | ATCTGCATCAGCGTCCGCCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 124 |
LEAP-Seq percent confirming: | 18.0706 |
LEAP-Seq n confirming: | 2274 |
LEAP-Seq n nonconfirming: | 10310 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAGCCATTGCCTCTTCTA |
Suggested primer 2: | CCTCTGCCCAATTACACGAT |